Recognition sites of rectriction enzymes

[raw]

* Acid Base Indicators

* Acids and Alkali

* Aging and Senescence

* Amino Acids – Feature

* Amino Acids – Structure

* Amniotic Fluid

* Base units (SI)

* Blood Indicators

* Buffer Mixtures

* Cell Animations

* Cell Image Gallery

* Cell Mentor

* Cell Spnapshots

* Cell Video Archives

* Cerebrospinal Fluid

* Enzymes
* Gastric Fluid

* Gene Nomenclature

* Genetic Code

* Greek Alphabet

* Heart EKGs

* Heart Sounds

* Hematologic Indicators

* Human CDs

* Human Non-CDs

* Ideal Weights and Heights

* Journals

* Libraries

* Mouse Primers

* Nomogram

* Pediatric Reference Values

* Periodic Table
* Physiologic Solutions

* Prefixes

* Restriction Enzymes

* Seminal Fluid Indicators

* SI Derived Units

* Species Abbreviations

* Stool Indicators

* Sweat Indicators
* Synovial Fluid Indicators

* Temperature Conversions

* Tris Buffer

* Tumor Atlas

* Urine Indicators

* Weights and Measures





































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































Aw441


G/TGCAC


Aat II


GACGI/C


AatII


GACGT/C


Acc65 I


G/GTACC


Acc65I


G/GTACC


AccB7 I


CCANNNN/NTGG


AccI


GT/MKAC


AccI


GT/(A/T)(T/G)AC


AccIll


T/CCGGA


AciI


CCGC(-3/-1)


AclI


AA/CGTT


AcuI


CTGAAG(16/14)


AcyI


G(A/G) /CG(T/C)C


AfeI


AGC/GCT


AflII


C/TTAAG


AflIII


A/CRYGT


Age l


A/CCGGT


AgeI AgeI-HF® AgeI-HF® RE-Mix®


A/CCGGT


AhdI


GACNNN/NNGTC


AleI


CACNN/NNGTG


Alu l


AG/CT


AluI


AG/CT


AlwI


GGATC(4/5)


AlwNI


CAGNNN/CTG


Apa l


GGGCC/C


ApaI


GGGCC/C


ApaLI


G/TGCAC


ApoI ApoI-HF


R/AATTY


AscI AscI RE-Mix®


GG/CGCGCC


AseI


AT/TAAT


AsiSI


GCGAT/CGC


Ava I


C/(T/C)CG(A/G)G


Ava lI


G/G(A/T)CC


AvaI BsoBI


C/YCGRG


AvaII


G/GWCC


AvrII


C/CTAGG


Ba/I


TGG/CCA


BaeGI


GKGCM/C


BaeI


(10/15)ACNNNNGTAYC(12/7)


BamH l


G/GATCC


BamHI BamHI-HF®


G/GATCC


Ban I


G/G (T/C)(A/G)CC


Ban II


G(A/G)GC(T/C) /C


BanI


G/GYRCC


BanII


GRGCY/C


BbsI


GAAGAC(2/6)


Bbu l


GCATG/C


BbvCI


CCTCAGC(-5/-2)


BbvI


GCAGC(8/12)


Bc/I


T/GATCA


BccI


CCATC(4/5)


BceAI


ACGGC(12/14)


BcgI


(10/12)CGANNNNNNTGC(12/10)


BciVI


GTATCC(6/5)


BclI


T/GATCA


BfaI


C/TAG


Bg/Il


A/GATCT


Bgl l


GCCNNNN/NGGC


BglI


GCCNNNN/NGGC


BglII


A/GATCT


BlpI


GC/TNAGC


BmgBI


CACGTC(-3/-3)


BmrI


ACTGGG(5/4)


BmtI BmtI-HF®


GCTAG/C


BpmI


CTGGAG(16/14)


Bpu10I


CCTNAGC(-5/-2)


BpuEI


CTTGAG(16/14)


BsaAI


YAC/GTR


BsaBI


GATNN/NNATC


BsaHI


GR/CGYC


BsaI BsaI-HF®


GGTCTC(1/5)


BsaJI


C/CNNGG


BsaM I


GATTGCN/


BsaO I


CG(A/G)(T/C) /CG


BsaWI


W/CCGGW


BsaXI


(9/12)ACNNNNNCTCC(10/7)


BseRI


GAGGAG(10/8)


BseYI


CCCAGC(-5/-1)


BsgI


GTGCAG(16/14)


BsiEI


CGRY/CG


BsiHKAI


GWGCW/C


BsiWI


C/GTACG


BslI


CCNNNNN/NNGG


BsmAI BcoDI


GTCTC(1/5)


BsmBI


CGTCTC(1/5)


BsmFI


GGGAC(10/14)


BsmI


GAATGC(1/-1)


Bsp1286 I


G(G/A/T)GC(C/A/T) /C


Bsp1286I


GDGCH/C


BspCNI


CTCAG(9/7)


BspEI


T/CCGGA


BspHI


T/CATGA


BspMI BfuAI


ACCTGC(4/8)


BsrBI


CCGCTC(-3/-3)


BsrBR I


GATNN/NNATC


BsrDI


GCAATG(2/0)


BsrFI


R/CCGGY


BsrGI BsrGI-HF®


T/GTACA


BsrI


ACTGG(1/-1)


BsrS I


ACTGGN/


BssH II


G/CGCGC


BssHII


G/CGCGC


BssKI StyD4I


/CCNGG


BssSI BssSαI


CACGAG(-5/-1)


Bst E II


G/GTNACC


Bst O I


CC/(A/T)GG


Bst X I


CCANNNNN/NTGG


Bst Z I


C/GGCCG


Bst71 I


GCAGC(8/12)


Bst98 I


C/TTAAG


BstAPI


GCANNNN/NTGC


BstBI


TT/CGAA


BstEII BstEII-HF® BstEII-HF® RE-Mix®


G/GTNACC


BstNI


CC/WGG


BstUI


CG/CG


BstXI


CCANNNNN/NTGG


BstYI


R/GATCY


BstZ17I


GTA/TAC


Bsu36 I


CC/TNAGG


Bsu36I


CC/TNAGG


BtgI


C/CRYGG


BtgZI


GCGATG(10/14)


BtsCI


GGATG(2/0)


BtsI BtsαI


GCAGTG(2/0)


BtsIMutI


CAGTG(2/0)


Cac8I


GCN/NGC


Cfo I


GCG/C


Cla l


AT/CGAT


ClaI BspDI


AT/CGAT


Csp 45 I


TT/CGAA


Csp I


CG/G(A/T)CCG


CspCI


(11/13)CAANNNNNGTGG(12/10)


CviAII


C/ATG


CviKI-1


RG/CY


CviQI


G/TAC


Dde I


C/TNAG


DdeI


C/TNAG


Dpn I


GmeA/TC


DpnI


GA/TC


Dra l


TTT/AAA


DraI


TTT/AAA


DraIII DraIII-HF®


CACNNN/GTG


DrdI


GACNNNN/NNGTC


EaeI


Y/GGCCR


EagI EagI-HF®


C/GGCCG


EarI


CTCTTC(1/4)


EciI


GGCGGA(11/9)


EclHK I


GACNNN/NNGTC


Eco47 III


ACG/GCT


Eco52 I


C/GGCCG


Eco53kI


GAG/CTC


Eco72 I


CAC/GTG


EcoI CR I


GAG/CJC


EcoNI


CCTNN/NNNAGG


EcoO109I


RG/GNCCY


EcoP15I


CAGCAG(25/27)


EcoR I


G/AATTC


EcoR V


GAT/ATC


EcoRI EcoRI-HF® EcoRI-HF® RE-Mix®


G/AATTC


EcoRV EcoRV-HF® EcoRV-HF® RE-Mix®


GAT/ATC


FatI


/CATG


FauI


CCCGC(4/6)


Fnu4HI


GC/NGC


Fok I


GGATG(9/13)


FokI


GGATG(9/13)


FseI


GGCCGG/CC


FspEI


CC(12/16)


FspI


TGC/GCA


Hae ll


(A/G)GCGC/(T/C)


HaeII


RGCGC/Y


HaeIII PhoI


GG/CC


HaelIl


GG/CC


HgaI


GACGC(5/10)


Hha I


GCG/C


HhaI


GCG/C


Hinc II


GT(T/C) /(A/G)AC


HincII


GTY/RAC


Hind III


A/AGCTT


HindIII HindIII-HF®


A/AGCTT


Hinf I


G/ANTC


HinfI


G/ANTC


HinP1I


G/CGC


Hpa I


GTT/AAC


Hpa II


C/CGG


HpaI


GTT/AAC


HphI


GGTGA(8/7)


Hpy166II


GTN/NAC


Hpy188I


TCN/GA


Hpy188III


TC/NNGA


Hpy99I


CGWCG/


HpyAV


CCTTC(6/5)


HpyCH4III


ACN/GT


HpyCH4IV


A/CGT


HpyCH4V


TG/CA


Hsp92 I


G(A/G) /CG(T/C)C


Hsp92 II


CATG/


I-CeuI


TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)


I-Ppo I


CTCTCTTAA/GGTAGC


I-SceI


TAGGGATAACAGGGTAAT(-9/-13)


KasI


G/GCGCC


Kpn I


GGTAC/C


KpnI KpnI-HF® KpnI-HF® RE-Mix®


GGTAC/C


LpnPI


CCDG(10/14)


Mbo I


/GATC


Mbo II


GAAGA(8/7)


MboI Sau3AI DpnII BfuCI


/GATC


MboII


GAAGA(8/7)


MfeI MfeI-HF® MfeI-HF® RE-Mix®


C/AATTG


Mlu l


A/CGCGT


MluCI Tsp509I


/AATT


MluI MluI-HF®


A/CGCGT


MlyI


GAGTC(5/5)


MmeI


TCCRAC(20/18)


MnlI


CCTC(7/6)


MscI


TGG/CCA


MseI


T/TAA


MslI


CAYNN/NNRTG


Msp I


C/CGG


MspA I


C(A/C)G/C(G/T)G


MspA1I


CMG/CKG


MspI HpaII


C/CGG


MspJI


CNNR(9/13)


MwoI


GCNNNNN/NNGC


Nae l


GCC/GGC


NaeI


GCC/GGC


Nar


GG/CGCC


NarI


GG/CGCC


Nb.BbvCI


CCTCAGC


Nb.BsmI


GAATGC


Nb.BsrDI


GCAATG


Nb.BtsI


GCAGTG


Nci I


CC/(G/C)GG


NciI


CC/SGG


Nco I


C/CATGG


NcoI NcoI-HF® NcoI-HF® RE-Mix®


C/CATGG


Nde l


CA/TATG


NdeI


CA/TATG


NgoM I


G/CCGGC


NgoMIV


G/CCGGC


Nhe I


G/CTAGC


NheI NheI-HF® NheI-HF® RE-Mix®


G/CTAGC


NlaIII


CATG/


NlaIV


GGN/NCC


NmeAIII


GCCGAG(21/19)


Not I


GC/GGCCGC


NotI NotI-HF® NotI-HF® RE-Mix®


GC/GGCCGC


Nru I


TCG/CGA


NruI NruI-HF®


TCG/CGA


Nsi l


ATGCA/T


NsiI NsiI-HF®


ATGCA/T


NspI


RCATG/Y


Nt.AlwI


GGATC(4/-5)


Nt.BbvCI


CCTCAGC(-5/-7)


Nt.BsmAI


GTCTC(1/-5)


Nt.BspQI


GCTCTTC(1/-7)


Nt.BstNBI


GAGTC(4/-5)


Nt.CviPII


(0/-1)CCD


PacI PacI RE-Mix®


TTAAT/TAA


PciI


A/CATGT


PflMI


CCANNNN/NTGG


PI-PspI


TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)


PI-SceI


ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)


PleI


GAGTC(4/5)


PluTI


GGCGC/C


PmeI


GTTT/AAAC


PmlI


CAC/GTG


PpuMI


RG/GWCCY


PshAI


GACNN/NNGTC


PsiI


TTA/TAA


PspGI


/CCWGG


PspOMI


G/GGCCC


PspXI


VC/TCGAGB


Pst l


CTGCA/G


PstI PstI-HF®


CTGCA/G


Pvu l


CGAT/CG


PvuI PvuI-HF®


CGAT/CG


PvuII PvuII-HF®


CAG/CTG


Rsa l


GT/AC


RsaI


GT/AC


RsrII


CG/GWCCG


Rvu II


CAG/CTG


Sac I


GAGGCT/C


Sac II


CCGC/GG


SacI SacI-HF®


GAGCT/C


SacII


CCGC/GG


Sal l


G/TCGAC


SalI SalI-HF® SalI-HF® RE-Mix®


G/TCGAC


SapI BspQI


GCTCTTC(1/4)


Sau3A I


/GATC


Sau96 I


G/GNCC


Sau96I


G/GNCC


SbfI SbfI-HF®


CCTGCA/GG


Sca l


AGT/ACT


ScaI ScaI-HF® ScaI-HF® RE-Mix®


AGT/ACT


ScrFI


CC/NGG


SexAI


A/CCWGGT


SfaNI


GCATC(5/9)


SfcI


C/TRYAG


Sfi I


GGCCNNNN/NGGCC


SfiI


GGCCNNNN/NGGCC


SfoI


GGC/GCC


Sgf I


GCGAT/CGC


SgrAI


CR/CCGGYG


Sin I


G/G(A/T)CC


Sma l


CCC/GGG


SmaI


CCC/GGG


SmlI


C/TYRAG


SnaB I


TAC/GTA


SnaBI


TAC/GTA


Spe l


A/CTAGT


SpeI SpeI-HF® SpeI RE-Mix®


A/CTAGT


Sph I


GCATG/C


SphI SphI-HF®


GCATG/C


SrfI


GCCC/GGGC


Ssp l


AAT/ATT


SspI SspI-HF®


AAT/ATT


Stu l


AGG/CCT


StuI


AGG/CCT


Sty l


C/C(A/T)(T/A)GG


StyI StyI-HF®


C/CWWGG


SwaI


ATTT/AAAT


Taq I


T/CGA


TaqαI


T/CGA


TfiI


G/AWTC


Tru9 I


T/TAA


TseI ApeKI


G/CWGC


Tsp45I


/GTSAC


TspRI


NNCASTGNN/


Tth111I PflFI


GACN/NNGTC


Tthlll I


GACN/NNGTC


Vsp I


A/TAAT


Xba I


T/CTAGA


XbaI XbaI RE-Mix®


T/CTAGA


XcmI


CCANNNNN/NNNNTGG


Xho I


C/TCGAG


Xho II


(A/G) /GATC(T/C)


XhoI PaeR7I TliI XhoI RE-Mix®


C/TCGAG


Xma l


C/CCGGG


XmaI TspMI


C/CCGGG


Xmn I


GAANN/NNTTC


XmnI


GAANN/NNTTC


ZraI


GAC/GTC


[/raw]