Recognition sites of rectriction enzymes

* Acid Base Indicators
* Acids and Alkali
* Aging and Senescence
* Amino Acids - Feature
* Amino Acids - Structure
* Amniotic Fluid
* Base units (SI)
* Blood Indicators
* Buffer Mixtures
* Cell Animations
* Cell Image Gallery
* Cell Mentor
* Cell Spnapshots
* Cell Video Archives
* Cerebrospinal Fluid
* Enzymes
* Gastric Fluid
* Gene Nomenclature
* Genetic Code
* Greek Alphabet
* Heart EKGs
* Heart Sounds
* Hematologic Indicators
* Human CDs
* Human Non-CDs
* Ideal Weights and Heights
* Journals
* Libraries
* Mouse Primers
* Nomogram
* Pediatric Reference Values
* Periodic Table
* Physiologic Solutions
* Prefixes
* Restriction Enzymes
* Seminal Fluid Indicators
* SI Derived Units
* Species Abbreviations
* Stool Indicators
* Sweat Indicators
* Synovial Fluid Indicators
* Temperature Conversions
* Tris Buffer
* Tumor Atlas
* Urine Indicators
* Weights and Measures

Aw441

G/TGCAC

Aat II

GACGI/C

AatII

GACGT/C

Acc65 I

G/GTACC

Acc65I

G/GTACC

AccB7 I

CCANNNN/NTGG

AccI

GT/MKAC

AccI

GT/(A/T)(T/G)AC

AccIll

T/CCGGA

AciI

CCGC(-3/-1)

AclI

AA/CGTT

AcuI

CTGAAG(16/14)

AcyI

G(A/G) /CG(T/C)C

AfeI

AGC/GCT

AflII

C/TTAAG

AflIII

A/CRYGT

Age l

A/CCGGT

AgeI AgeI-HF® AgeI-HF® RE-Mix®

A/CCGGT

AhdI

GACNNN/NNGTC

AleI

CACNN/NNGTG

Alu l

AG/CT

AluI

AG/CT

AlwI

GGATC(4/5)

AlwNI

CAGNNN/CTG

Apa l

GGGCC/C

ApaI

GGGCC/C

ApaLI

G/TGCAC

ApoI ApoI-HF

R/AATTY

AscI AscI RE-Mix®

GG/CGCGCC

AseI

AT/TAAT

AsiSI

GCGAT/CGC

Ava I

C/(T/C)CG(A/G)G

Ava lI

G/G(A/T)CC

AvaI BsoBI

C/YCGRG

AvaII

G/GWCC

AvrII

C/CTAGG

Ba/I

TGG/CCA

BaeGI

GKGCM/C

BaeI

(10/15)ACNNNNGTAYC(12/7)

BamH l

G/GATCC

BamHI BamHI-HF®

G/GATCC

Ban I

G/G (T/C)(A/G)CC

Ban II

G(A/G)GC(T/C) /C

BanI

G/GYRCC

BanII

GRGCY/C

BbsI

GAAGAC(2/6)

Bbu l

GCATG/C

BbvCI

CCTCAGC(-5/-2)

BbvI

GCAGC(8/12)

Bc/I

T/GATCA

BccI

CCATC(4/5)

BceAI

ACGGC(12/14)

BcgI

(10/12)CGANNNNNNTGC(12/10)

BciVI

GTATCC(6/5)

BclI

T/GATCA

BfaI

C/TAG

Bg/Il

A/GATCT

Bgl l

GCCNNNN/NGGC

BglI

GCCNNNN/NGGC

BglII

A/GATCT

BlpI

GC/TNAGC

BmgBI

CACGTC(-3/-3)

BmrI

ACTGGG(5/4)

BmtI BmtI-HF®

GCTAG/C

BpmI

CTGGAG(16/14)

Bpu10I

CCTNAGC(-5/-2)

BpuEI

CTTGAG(16/14)

BsaAI

YAC/GTR

BsaBI

GATNN/NNATC

BsaHI

GR/CGYC

BsaI BsaI-HF®

GGTCTC(1/5)

BsaJI

C/CNNGG

BsaM I

GATTGCN/

BsaO I

CG(A/G)(T/C) /CG

BsaWI

W/CCGGW

BsaXI

(9/12)ACNNNNNCTCC(10/7)

BseRI

GAGGAG(10/8)

BseYI

CCCAGC(-5/-1)

BsgI

GTGCAG(16/14)

BsiEI

CGRY/CG

BsiHKAI

GWGCW/C

BsiWI

C/GTACG

BslI

CCNNNNN/NNGG

BsmAI BcoDI

GTCTC(1/5)

BsmBI

CGTCTC(1/5)

BsmFI

GGGAC(10/14)

BsmI

GAATGC(1/-1)

Bsp1286 I

G(G/A/T)GC(C/A/T) /C

Bsp1286I

GDGCH/C

BspCNI

CTCAG(9/7)

BspEI

T/CCGGA

BspHI

T/CATGA

BspMI BfuAI

ACCTGC(4/8)

BsrBI

CCGCTC(-3/-3)

BsrBR I

GATNN/NNATC

BsrDI

GCAATG(2/0)

BsrFI

R/CCGGY

BsrGI BsrGI-HF®

T/GTACA

BsrI

ACTGG(1/-1)

BsrS I

ACTGGN/

BssH II

G/CGCGC

BssHII

G/CGCGC

BssKI StyD4I

/CCNGG

BssSI BssSαI

CACGAG(-5/-1)

Bst E II

G/GTNACC

Bst O I

CC/(A/T)GG

Bst X I

CCANNNNN/NTGG

Bst Z I

C/GGCCG

Bst71 I

GCAGC(8/12)

Bst98 I

C/TTAAG

BstAPI

GCANNNN/NTGC

BstBI

TT/CGAA

BstEII BstEII-HF® BstEII-HF® RE-Mix®

G/GTNACC

BstNI

CC/WGG

BstUI

CG/CG

BstXI

CCANNNNN/NTGG

BstYI

R/GATCY

BstZ17I

GTA/TAC

Bsu36 I

CC/TNAGG

Bsu36I

CC/TNAGG

BtgI

C/CRYGG

BtgZI

GCGATG(10/14)

BtsCI

GGATG(2/0)

BtsI BtsαI

GCAGTG(2/0)

BtsIMutI

CAGTG(2/0)

Cac8I

GCN/NGC

Cfo I

GCG/C

Cla l

AT/CGAT

ClaI BspDI

AT/CGAT

Csp 45 I

TT/CGAA

Csp I

CG/G(A/T)CCG

CspCI

(11/13)CAANNNNNGTGG(12/10)

CviAII

C/ATG

CviKI-1

RG/CY

CviQI

G/TAC

Dde I

C/TNAG

DdeI

C/TNAG

Dpn I

GmeA/TC

DpnI

GA/TC

Dra l

TTT/AAA

DraI

TTT/AAA

DraIII DraIII-HF®

CACNNN/GTG

DrdI

GACNNNN/NNGTC

EaeI

Y/GGCCR

EagI EagI-HF®

C/GGCCG

EarI

CTCTTC(1/4)

EciI

GGCGGA(11/9)

EclHK I

GACNNN/NNGTC

Eco47 III

ACG/GCT

Eco52 I

C/GGCCG

Eco53kI

GAG/CTC

Eco72 I

CAC/GTG

EcoI CR I

GAG/CJC

EcoNI

CCTNN/NNNAGG

EcoO109I

RG/GNCCY

EcoP15I

CAGCAG(25/27)

EcoR I

G/AATTC

EcoR V

GAT/ATC

EcoRI EcoRI-HF® EcoRI-HF® RE-Mix®

G/AATTC

EcoRV EcoRV-HF® EcoRV-HF® RE-Mix®

GAT/ATC

FatI

/CATG

FauI

CCCGC(4/6)

Fnu4HI

GC/NGC

Fok I

GGATG(9/13)

FokI

GGATG(9/13)

FseI

GGCCGG/CC

FspEI

CC(12/16)

FspI

TGC/GCA

Hae ll

(A/G)GCGC/(T/C)

HaeII

RGCGC/Y

HaeIII PhoI

GG/CC

HaelIl

GG/CC

HgaI

GACGC(5/10)

Hha I

GCG/C

HhaI

GCG/C

Hinc II

GT(T/C) /(A/G)AC

HincII

GTY/RAC

Hind III

A/AGCTT

HindIII HindIII-HF®

A/AGCTT

Hinf I

G/ANTC

HinfI

G/ANTC

HinP1I

G/CGC

Hpa I

GTT/AAC

Hpa II

C/CGG

HpaI

GTT/AAC

HphI

GGTGA(8/7)

Hpy166II

GTN/NAC

Hpy188I

TCN/GA

Hpy188III

TC/NNGA

Hpy99I

CGWCG/

HpyAV

CCTTC(6/5)

HpyCH4III

ACN/GT

HpyCH4IV

A/CGT

HpyCH4V

TG/CA

Hsp92 I

G(A/G) /CG(T/C)C

Hsp92 II

CATG/

I-CeuI

TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)

I-Ppo I

CTCTCTTAA/GGTAGC

I-SceI

TAGGGATAACAGGGTAAT(-9/-13)

KasI

G/GCGCC

Kpn I

GGTAC/C

KpnI KpnI-HF® KpnI-HF® RE-Mix®

GGTAC/C

LpnPI

CCDG(10/14)

Mbo I

/GATC

Mbo II

GAAGA(8/7)

MboI Sau3AI DpnII BfuCI

/GATC

MboII

GAAGA(8/7)

MfeI MfeI-HF® MfeI-HF® RE-Mix®

C/AATTG

Mlu l

A/CGCGT

MluCI Tsp509I

/AATT

MluI MluI-HF®

A/CGCGT

MlyI

GAGTC(5/5)

MmeI

TCCRAC(20/18)

MnlI

CCTC(7/6)

MscI

TGG/CCA

MseI

T/TAA

MslI

CAYNN/NNRTG

Msp I

C/CGG

MspA I

C(A/C)G/C(G/T)G

MspA1I

CMG/CKG

MspI HpaII

C/CGG

MspJI

CNNR(9/13)

MwoI

GCNNNNN/NNGC

Nae l

GCC/GGC

NaeI

GCC/GGC

Nar

GG/CGCC

NarI

GG/CGCC

Nb.BbvCI

CCTCAGC

Nb.BsmI

GAATGC

Nb.BsrDI

GCAATG

Nb.BtsI

GCAGTG

Nci I

CC/(G/C)GG

NciI

CC/SGG

Nco I

C/CATGG

NcoI NcoI-HF® NcoI-HF® RE-Mix®

C/CATGG

Nde l

CA/TATG

NdeI

CA/TATG

NgoM I

G/CCGGC

NgoMIV

G/CCGGC

Nhe I

G/CTAGC

NheI NheI-HF® NheI-HF® RE-Mix®

G/CTAGC

NlaIII

CATG/

NlaIV

GGN/NCC

NmeAIII

GCCGAG(21/19)

Not I

GC/GGCCGC

NotI NotI-HF® NotI-HF® RE-Mix®

GC/GGCCGC

Nru I

TCG/CGA

NruI NruI-HF®

TCG/CGA

Nsi l

ATGCA/T

NsiI NsiI-HF®

ATGCA/T

NspI

RCATG/Y

Nt.AlwI

GGATC(4/-5)

Nt.BbvCI

CCTCAGC(-5/-7)

Nt.BsmAI

GTCTC(1/-5)

Nt.BspQI

GCTCTTC(1/-7)

Nt.BstNBI

GAGTC(4/-5)

Nt.CviPII

(0/-1)CCD

PacI PacI RE-Mix®

TTAAT/TAA

PciI

A/CATGT

PflMI

CCANNNN/NTGG

PI-PspI

TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)

PI-SceI

ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)

PleI

GAGTC(4/5)

PluTI

GGCGC/C

PmeI

GTTT/AAAC

PmlI

CAC/GTG

PpuMI

RG/GWCCY

PshAI

GACNN/NNGTC

PsiI

TTA/TAA

PspGI

/CCWGG

PspOMI

G/GGCCC

PspXI

VC/TCGAGB

Pst l

CTGCA/G

PstI PstI-HF®

CTGCA/G

Pvu l

CGAT/CG

PvuI PvuI-HF®

CGAT/CG

PvuII PvuII-HF®

CAG/CTG

Rsa l

GT/AC

RsaI

GT/AC

RsrII

CG/GWCCG

Rvu II

CAG/CTG

Sac I

GAGGCT/C

Sac II

CCGC/GG

SacI SacI-HF®

GAGCT/C

SacII

CCGC/GG

Sal l

G/TCGAC

SalI SalI-HF® SalI-HF® RE-Mix®

G/TCGAC

SapI BspQI

GCTCTTC(1/4)

Sau3A I

/GATC

Sau96 I

G/GNCC

Sau96I

G/GNCC

SbfI SbfI-HF®

CCTGCA/GG

Sca l

AGT/ACT

ScaI ScaI-HF® ScaI-HF® RE-Mix®

AGT/ACT

ScrFI

CC/NGG

SexAI

A/CCWGGT

SfaNI

GCATC(5/9)

SfcI

C/TRYAG

Sfi I

GGCCNNNN/NGGCC

SfiI

GGCCNNNN/NGGCC

SfoI

GGC/GCC

Sgf I

GCGAT/CGC

SgrAI

CR/CCGGYG

Sin I

G/G(A/T)CC

Sma l

CCC/GGG

SmaI

CCC/GGG

SmlI

C/TYRAG

SnaB I

TAC/GTA

SnaBI

TAC/GTA

Spe l

A/CTAGT

SpeI SpeI-HF® SpeI RE-Mix®

A/CTAGT

Sph I

GCATG/C

SphI SphI-HF®

GCATG/C

SrfI

GCCC/GGGC

Ssp l

AAT/ATT

SspI SspI-HF®

AAT/ATT

Stu l

AGG/CCT

StuI

AGG/CCT

Sty l

C/C(A/T)(T/A)GG

StyI StyI-HF®

C/CWWGG

SwaI

ATTT/AAAT

Taq I

T/CGA

TaqαI

T/CGA

TfiI

G/AWTC

Tru9 I

T/TAA

TseI ApeKI

G/CWGC

Tsp45I

/GTSAC

TspRI

NNCASTGNN/

Tth111I PflFI

GACN/NNGTC

Tthlll I

GACN/NNGTC

Vsp I

A/TAAT

Xba I

T/CTAGA

XbaI XbaI RE-Mix®

T/CTAGA

XcmI

CCANNNNN/NNNNTGG

Xho I

C/TCGAG

Xho II

(A/G) /GATC(T/C)

XhoI PaeR7I TliI XhoI RE-Mix®

C/TCGAG

Xma l

C/CCGGG

XmaI TspMI

C/CCGGG

Xmn I

GAANN/NNTTC

XmnI

GAANN/NNTTC

ZraI

GAC/GTC