Mouse Primers

[raw]

* Acid Base Indicators

* Acids and Alkali

* Aging and Senescence

* Amino Acids – Feature

* Amino Acids – Structure

* Amniotic Fluid

* Base units (SI)

* Blood Indicators

* Buffer Mixtures

* Cell Animations

* Cell Image Gallery

* Cell Mentor

* Cell Spnapshots

* Cell Video Archives

* Cerebrospinal Fluid

* Enzymes
* Gastric Fluid

* Gene Nomenclature

* Genetic Code

* Greek Alphabet

* Heart EKGs

* Heart Sounds

* Hematologic Indicators

* Human CDs

* Human Non-CDs

* Ideal Weights and Heights

* Journals

* Libraries

* Mouse Primers

* Nomogram

* Pediatric Reference Values

* Periodic Table
* Physiologic Solutions

* Prefixes

* Restriction Enzymes

* Seminal Fluid Indicators

* SI Derived Units

* Species Abbreviations

* Stool Indicators

* Sweat Indicators
* Synovial Fluid Indicators

* Temperature Conversions

* Tris Buffer

* Tumor Atlas

* Urine Indicators

* Weights and Measures





























































































































































































































































Name


Forward Primer (5′à
3′)


Reverse Primer (5′à
3′)


Stem Cells


Acrosin


CGGAGTCTACACAGCCACCT


GCATGAGTGATGAGGAGGTT


Cdx2


CCCAGCGGCCAGCGGCGAAACCTGT


TTCTCGCAGCGTCCATACTCCTCAT


Cripto


GCGCACGCTTCCAACTCTACAATC 3′


TTCCAAGGCAACCAGGGCTACAC 3′


Dazl


GCCAGCACTCAGTCTTC ATC


GTTGGAGGCTGCATGTAAGT


Dlx3


ATCTCAATGGGCTCGCAG


ATGGAGTCACTGTTGTTGGG


Esx1


GCAACCCCAACAGGAGC


GGACTCATGGCGACTGGA


Fgls


TTGCTCCGCACCATGAACCA


TGAAGCACTTCAGGACCGGA


Gcm1


AGACCAAGCTGGAAGCAGAG


GCATGTTGCTGCTGAGTAGG


Gcnf


GTGGAAGACCAGGACGACGA


CCTAC TGGATGATAGTGTGG


GDF-9


ATCGAGTGCAGTGTCCGTAGGT


TTCACTTGGTTTATGGCAACGA


Hand1


GCGCCTGGCTACCAGTTACA


AGCAACGCCTTCCCTCTAGG


haprin


CCAGAACATGAGACAGAGAG


AGCAACTTCCTGAGCATACC


Hprt


GCTGGTGAAAAGGACC TCT


CACAGGACTAGAACACCTGC


Id2


TCTGAGCTTATGTCGAATGATAGC


CACAGCATTCAGTAGGCTCGTGTC


Lefty-1


GCTCACACAAGTTGGTTCGTTTC3′


CCTCCCTCCTTCACGCTGAC


LH


TGCAACCTCCTCAATCTGTC


AGCGTGGCAACCAGTAGGCT


MIS


TTGGTGCTAA CCGTGGACTT


GCAGAGCACGAACCAAGCGA


Nanog


AGGGTCTGCTACTGAGATGCTCTG


CAACCACTGGTTTTTCTGCCACCG


Oct4


GAACAGTTTGCCAAGCTGCTG


CCGGTTACAGAACCATACTCG


Oct4


GTGGATTCTCGAACCTGGCT


GTCTCCAGACTCC ACCTCAC


P450 17-alpha


TGGAGGCCACTATCCGAGAA


TGTTAGCCTTGTGTGGGATGAG


P450 aromatase


TCATAGCTCCTATGGTTTGTCATCA


TCACTGGTCCCCAACACAGA


Piwil2


CCGTCATGAAGG AGAGCTCG


GGAACGACTCTGTGCTGGAT


PL-1


CTCACTTGGAGCCTACATTG


ACCAGGTGTTTCAGAGGTTC


Rnf17


GACACA CAGTCTAACAGAGG


AGGACAGCAGCATCTACCTT


Rnh2


CATAAGTGGCAACGAAGAGC


GTTACAGGCTGCTACCATCA


Sry


TTACAGCCTGCAG TTGCCTC


GGTCATAGAACTGCTGTTGC


ß-actin


CGTGCGTGACATCAAAGAGAAGC


ATCTGCTGGAAGGTGGACAGTGAG


stella


CAGCCGTACCTGTGGAGAACAAGAG


AGCCCTGGGCCTCACAGCTT


Tdrd1


GCAGTTCTGCTCTGTCAAGG


CAGAGCGTGGAATCACA TGG


Tec


ATAAGAAAGACCCTGCCTCCC


AAGCCTCACCACTCCAAACA


Tex14


GAAGCTTGAGCAGGAGGTAG


TTCAGAAGACA CAGACGCCA


Tfeb


GCGCATGCAGCAGCAGGCTGTC


CTGGGGATGCTGCTGGGGCAGG


Tpbp


CAGGTACTTGAGACATGACTC


GGCAGAGATTTCTTAGACAATG


Zp1


GAGTGACTGTGTTGCCATAG


GCCACACTGGTCTCACTACG


Zp2


GCTACACACATGACTCTCAC


GGTGACTCACAGTGGCA CTC


Zp3


TTGAGCAGAAGCAGTCCAGC


CGGTTGCCTTGT GGATGGTC


Germ Cells


c-Kit


CATCCATCCATCCAGCACAA


TCAAGGCTATCCCTGTTGTG


FIGa


TGCTGGAGGAGCTGATTCAG


CTGTGCGAGTGGCTTGAAGA


Vasa


ACTCCTGTGCAGAAGTACAC


GTTTGTTGCTGTTGGGCAAGC


SRY


GGAGGCACAGAGATTGAAGA


CAGTTCCATAACCACCACCA


DMC1


GTGTGACAGCTCAACTTCCA


CCAGGAGCAACTTATGACCTT


SCP3


GTGGAAGAAAGCATTCTGGG


CAGCAGCAAGAGATGGCAAA


MASH2


TGAAGGTGCAAACGTCCACT


AGAAGCTGAGTAAGGTGGAC


HAND1


CCAAACGAAAAGGCTCAGGA


GGCTGAACTCAAAAAGACGG


Pl1


TGGTGTCAAGCCTACTCCTT


CAACAGGTCTCAGGCTAACT


Tpbp


TCCTAGTCATCCTATGCCTG


CCACAGCCAGTTGTTGATGA


Trophoblasts


18s rRNA


AGGAATTGACGGAAGGGCACC


GGACATCTAAGGGCATCACAG


CGβ


ATGGAGATGTTCCAGGGGC


TTGTGGGAGGATCGGGGT


E12


ACCAGCCCAGACGAGGACGAGGACGACC


GGGCTTCTCGCTGTTGAGGTGCAG


E47


AGCAGTACGGACGAGGTGCTGTCCCTGG


CGCTTTGTCCGACTTGAGGTGCAT


GAPDH


CCATGGAGAAGGCTGGGG


CAAAGTTGTCATGGATGACC


Hasap


TCTTAGGGAGAAGTTCTCGACG


CCCTCCATCTGCAGTATCCC


Hash-2


CCTCGCCCTCCCGCGCTTCTT


CCCGGCTGTTACCTCATAGG


HEB


ACTGAAAACAAAGAAAAGGATGAAAACC


CCCTTTCTATCTTCTGTTCAGGGTTC


ID-1


AGTTGGAGCTGAACTCGGAATC


AGAAACACACGAGTGGAATCCC


ID-2


ATGAAAGCCTTCAGTCCCGTG


TCAGCCACACAGTGCTTTGC


I-mfa


CCACAGAAGCTGTTACATGCC


TGCACAGCGTCAGGAACTC


ITF-2


GGCAACCCAGGAACCCTTTC


TGAAGATGGCAAACCTGGAGG


Stra13


AAATCATTGCCCTGCAGAG


CTCCGATTCTCCTCCATAGC


[/raw]