Mouse Primers

* Acid Base Indicators
* Acids and Alkali
* Aging and Senescence
* Amino Acids - Feature
* Amino Acids - Structure
* Amniotic Fluid
* Base units (SI)
* Blood Indicators
* Buffer Mixtures
* Cell Animations
* Cell Image Gallery
* Cell Mentor
* Cell Spnapshots
* Cell Video Archives
* Cerebrospinal Fluid
* Enzymes
* Gastric Fluid
* Gene Nomenclature
* Genetic Code
* Greek Alphabet
* Heart EKGs
* Heart Sounds
* Hematologic Indicators
* Human CDs
* Human Non-CDs
* Ideal Weights and Heights
* Journals
* Libraries
* Mouse Primers
* Nomogram
* Pediatric Reference Values
* Periodic Table
* Physiologic Solutions
* Prefixes
* Restriction Enzymes
* Seminal Fluid Indicators
* SI Derived Units
* Species Abbreviations
* Stool Indicators
* Sweat Indicators
* Synovial Fluid Indicators
* Temperature Conversions
* Tris Buffer
* Tumor Atlas
* Urine Indicators
* Weights and Measures

Name

Forward Primer (5'à 3')

Reverse Primer (5'à 3')

Stem Cells

Acrosin

CGGAGTCTACACAGCCACCT

GCATGAGTGATGAGGAGGTT

Cdx2

CCCAGCGGCCAGCGGCGAAACCTGT

TTCTCGCAGCGTCCATACTCCTCAT

Cripto

GCGCACGCTTCCAACTCTACAATC 3'

TTCCAAGGCAACCAGGGCTACAC 3'

Dazl

GCCAGCACTCAGTCTTC ATC

GTTGGAGGCTGCATGTAAGT

Dlx3

ATCTCAATGGGCTCGCAG

ATGGAGTCACTGTTGTTGGG

Esx1

GCAACCCCAACAGGAGC

GGACTCATGGCGACTGGA

Fgls

TTGCTCCGCACCATGAACCA

TGAAGCACTTCAGGACCGGA

Gcm1

AGACCAAGCTGGAAGCAGAG

GCATGTTGCTGCTGAGTAGG

Gcnf

GTGGAAGACCAGGACGACGA

CCTAC TGGATGATAGTGTGG

GDF-9

ATCGAGTGCAGTGTCCGTAGGT

TTCACTTGGTTTATGGCAACGA

Hand1

GCGCCTGGCTACCAGTTACA

AGCAACGCCTTCCCTCTAGG

haprin

CCAGAACATGAGACAGAGAG

AGCAACTTCCTGAGCATACC

Hprt

GCTGGTGAAAAGGACC TCT

CACAGGACTAGAACACCTGC

Id2

TCTGAGCTTATGTCGAATGATAGC

CACAGCATTCAGTAGGCTCGTGTC

Lefty-1

GCTCACACAAGTTGGTTCGTTTC3'

CCTCCCTCCTTCACGCTGAC

LH

TGCAACCTCCTCAATCTGTC

AGCGTGGCAACCAGTAGGCT

MIS

TTGGTGCTAA CCGTGGACTT

GCAGAGCACGAACCAAGCGA

Nanog

AGGGTCTGCTACTGAGATGCTCTG

CAACCACTGGTTTTTCTGCCACCG

Oct4

GAACAGTTTGCCAAGCTGCTG

CCGGTTACAGAACCATACTCG

Oct4

GTGGATTCTCGAACCTGGCT

GTCTCCAGACTCC ACCTCAC

P450 17-alpha

TGGAGGCCACTATCCGAGAA

TGTTAGCCTTGTGTGGGATGAG

P450 aromatase

TCATAGCTCCTATGGTTTGTCATCA

TCACTGGTCCCCAACACAGA

Piwil2

CCGTCATGAAGG AGAGCTCG

GGAACGACTCTGTGCTGGAT

PL-1

CTCACTTGGAGCCTACATTG

ACCAGGTGTTTCAGAGGTTC

Rnf17

GACACA CAGTCTAACAGAGG

AGGACAGCAGCATCTACCTT

Rnh2

CATAAGTGGCAACGAAGAGC

GTTACAGGCTGCTACCATCA

Sry

TTACAGCCTGCAG TTGCCTC

GGTCATAGAACTGCTGTTGC

ß-actin

CGTGCGTGACATCAAAGAGAAGC

ATCTGCTGGAAGGTGGACAGTGAG

stella

CAGCCGTACCTGTGGAGAACAAGAG

AGCCCTGGGCCTCACAGCTT

Tdrd1

GCAGTTCTGCTCTGTCAAGG

CAGAGCGTGGAATCACA TGG

Tec

ATAAGAAAGACCCTGCCTCCC

AAGCCTCACCACTCCAAACA

Tex14

GAAGCTTGAGCAGGAGGTAG

TTCAGAAGACA CAGACGCCA

Tfeb

GCGCATGCAGCAGCAGGCTGTC

CTGGGGATGCTGCTGGGGCAGG

Tpbp

CAGGTACTTGAGACATGACTC

GGCAGAGATTTCTTAGACAATG

Zp1

GAGTGACTGTGTTGCCATAG

GCCACACTGGTCTCACTACG

Zp2

GCTACACACATGACTCTCAC

GGTGACTCACAGTGGCA CTC

Zp3

TTGAGCAGAAGCAGTCCAGC

CGGTTGCCTTGT GGATGGTC

Germ Cells

c-Kit

CATCCATCCATCCAGCACAA

TCAAGGCTATCCCTGTTGTG

FIGa

TGCTGGAGGAGCTGATTCAG

CTGTGCGAGTGGCTTGAAGA

Vasa

ACTCCTGTGCAGAAGTACAC

GTTTGTTGCTGTTGGGCAAGC

SRY

GGAGGCACAGAGATTGAAGA

CAGTTCCATAACCACCACCA

DMC1

GTGTGACAGCTCAACTTCCA

CCAGGAGCAACTTATGACCTT

SCP3

GTGGAAGAAAGCATTCTGGG

CAGCAGCAAGAGATGGCAAA

MASH2

TGAAGGTGCAAACGTCCACT

AGAAGCTGAGTAAGGTGGAC

HAND1

CCAAACGAAAAGGCTCAGGA

GGCTGAACTCAAAAAGACGG

Pl1

TGGTGTCAAGCCTACTCCTT

CAACAGGTCTCAGGCTAACT

Tpbp

TCCTAGTCATCCTATGCCTG

CCACAGCCAGTTGTTGATGA

Trophoblasts

18s rRNA

AGGAATTGACGGAAGGGCACC

GGACATCTAAGGGCATCACAG

CGβ

ATGGAGATGTTCCAGGGGC

TTGTGGGAGGATCGGGGT

E12

ACCAGCCCAGACGAGGACGAGGACGACC

GGGCTTCTCGCTGTTGAGGTGCAG

E47

AGCAGTACGGACGAGGTGCTGTCCCTGG

CGCTTTGTCCGACTTGAGGTGCAT

GAPDH

CCATGGAGAAGGCTGGGG

CAAAGTTGTCATGGATGACC

Hasap

TCTTAGGGAGAAGTTCTCGACG

CCCTCCATCTGCAGTATCCC

Hash-2

CCTCGCCCTCCCGCGCTTCTT

CCCGGCTGTTACCTCATAGG

HEB

ACTGAAAACAAAGAAAAGGATGAAAACC

CCCTTTCTATCTTCTGTTCAGGGTTC

ID-1

AGTTGGAGCTGAACTCGGAATC

AGAAACACACGAGTGGAATCCC

ID-2

ATGAAAGCCTTCAGTCCCGTG

TCAGCCACACAGTGCTTTGC

I-mfa

CCACAGAAGCTGTTACATGCC

TGCACAGCGTCAGGAACTC

ITF-2

GGCAACCCAGGAACCCTTTC

TGAAGATGGCAAACCTGGAGG

Stra13

AAATCATTGCCCTGCAGAG

CTCCGATTCTCCTCCATAGC